Genetic Markers May Predict Melanoma Survival
NYU Langone researchers have discovered an inherited genetic marker that might provide a way to better gauge survival from melanoma.
Genetic Mechanism Involved in Immune Attacks Identified
NYU Langone researchers find genetic mechanism for an immune protein that causes inflammation and activates cells that destroy viral particles.
Genetic Study Suggests Why Humans No Longer Have Tails
Study led by NYU Langone researchers—comparing the genetic codes of humans, apes, and old world monkeys—finds a genetic change in our ancestors.
Genetic Testing Important for People with Pancreatic Cancer
Genetic counselors at NYU Langone’s Perlmutter Cancer Center discuss the importance of genetic testing for people who have pancreatic cancer.
Genetic Therapies & Sleep Research Inform Epilepsy Treatment
NYU Langone researchers have a new understanding of epilepsy’s genetic roots that is giving rise to new treatment options for patients.
Genetically Engineered Pigs Used to Study Arrhythmias
NYU Langone researchers have developed the first large animal model of an inherited arrhythmic syndrome to better understand the condition.
Genetics of Nearby Healthy Tissue May Catch Cancer’s Return
An NYU Langone study shows that the genetics of healthy tissue near lung tumors may predict whether cancer will return after treatment.
Genetics Researcher to Lead New Institute
Leading genetics researcher Itai Yanai, PhD, has been named inaugural director of NYU Langone’s new Institute for Computational Medicine.
Genome Project-write to Launch in 2016
NYU Langone researchers part of The Genome Project-write, which seeks to build a synthetic human genome in a living cell within ten years.
Genotype: Dlx 5/6 Flp
GENOTYPE: Ai32 PRIMERS: oIMR9020: AAGGGAGCTGCAGTGGAGTA oIMR9021: CCGAAAATCTGTGGGAAGTC oIMR9102: ACATGGTCCTGCTGGAGTTC ...