Genetically Engineered Pigs Used to Study Arrhythmias
NYU Langone researchers have developed the first large animal model of an inherited arrhythmic syndrome to better understand the condition.
Genetics of Nearby Healthy Tissue May Catch Cancer’s Return
An NYU Langone study shows that the genetics of healthy tissue near lung tumors may predict whether cancer will return after treatment.
Genetics Researcher to Lead New Institute
Leading genetics researcher Itai Yanai, PhD, has been named inaugural director of NYU Langone’s new Institute for Computational Medicine.
Genome Project-write to Launch in 2016
NYU Langone researchers part of The Genome Project-write, which seeks to build a synthetic human genome in a living cell within ten years.
Genotype: Dlx 5/6 Flp
GENOTYPE: Ai32 PRIMERS: oIMR9020: AAGGGAGCTGCAGTGGAGTA oIMR9021: CCGAAAATCTGTGGGAAGTC oIMR9102: ACATGGTCCTGCTGGAGTTC ...
Get the Facts About Menopause & Hormone Therapy
NYU Langone menopause specialists Samantha M. Dunham, MD, and Laurie S. Jeffers, NP, DNP, discuss how hormone therapy treats menopause symptoms.
Getting Older Doesn’t Mean Giving Up Your Favorite Workouts
NYU Langone sports health expert and exercise physiologist Heather Milton discusses best practices to maximize post-workout recovery as you age.
Gift Paves Way for Future Biomedical Breakthroughs
NYU Langone Health today announced a $15 million gift from the Blavatnik Family Foundation to support research led by Evgeny A. Nudler, PhD.
Gifts Totaling $260 Million Support Major Campus Expansion
NYU Langone received gifts totaling $260 million for a major expansion of the hospital and medical school. Annual giving reached $500 Million.
Glaucoma May Be More Than Just an Issue of Eye Pressure
NYU Langone researchers find that citicoline protects against vision loss in glaucoma without reducing eye pressure.